View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20439_low_1 (Length: 377)
Name: NF20439_low_1
Description: NF20439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20439_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 203 - 363
Target Start/End: Original strand, 56012722 - 56012882
Alignment:
| Q |
203 |
acgggttccttgggcttttctggttctttaggcttgggaggtggaggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012722 |
acgggttccttgggcttttctggttctttaggcttgggaggtggaggaggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatct |
56012821 |
T |
 |
| Q |
303 |
tgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgttgttcttctc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56012822 |
tgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgttgttcttctc |
56012882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 56012537 - 56012615
Alignment:
| Q |
18 |
gttttggtggttcaggcttcggctcaggtggtggaggtgcaggcttttctttgggtttctcaggctctttaggcttttc |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
56012537 |
gttttggtggttcaggcttcggctcaggtggtggaggtgcaggcttttctttgggtttctcaggctctttgggcttttc |
56012615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 337
Target Start/End: Complemental strand, 19923853 - 19923767
Alignment:
| Q |
251 |
ggttcgacaatttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccact |
337 |
Q |
| |
|
||||| || ||||||||||||||||||| ||||| |||| |||||||| |||||||||| |||||| ||||| || || |||||| |
|
|
| T |
19923853 |
ggttcaactatttctatgcttttgatggtaccacccccttgacaacaaatattgtctcttaccttctctgggctgcagcacaccact |
19923767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 260 - 354
Target Start/End: Original strand, 9687542 - 9687636
Alignment:
| Q |
260 |
atttctatgcttttgatggcaccacaacctttgcaacaaatcttgtctcttatcttctcggggctacaacaaaccactgtgattgtcacgatgtt |
354 |
Q |
| |
|
||||| ||||| ||||| | ||| | ||||||| |||||| |||||| || |||||||| || |||||||| ||||| ||||||||||| ||||| |
|
|
| T |
9687542 |
atttcaatgctcttgatagaacctccacctttgtaacaaagcttgtccctaatcttctcaggactacaacacaccaccgtgattgtcacaatgtt |
9687636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University