View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20441_low_6 (Length: 352)
Name: NF20441_low_6
Description: NF20441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20441_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 5 - 337
Target Start/End: Complemental strand, 12216910 - 12216578
Alignment:
| Q |
5 |
ggtagattattctgattctcttatttttcacagtgatctagctagctgatgagttgttaccttgtgtgcctatatttcctcactgatcttgctgccacac |
104 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12216910 |
ggtagaatattctgattctcttatttttcacagtgatctagctagctgatgagttgttaccttgtgtgcctatatttcctcactgatcttactgccacac |
12216811 |
T |
 |
| Q |
105 |
gtgctttgccttgctcatattattgtagctgtcaaagttattttcgtcccacacatcatagattcatagcaaccagtttttgtcctatgcttccaatttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216810 |
gtgctttgccttgctcatattattgtagctgtcaaagttattttcgtcccacacatcatagattcatagcaaccagtttttgtcctatgcttccaatttt |
12216711 |
T |
 |
| Q |
205 |
ggactaaattttcatatatagtaccccctatatgtcagccatcacaattttgttggttattgtttaattacatatgnnnnnnnnngaaggatttaattac |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12216710 |
ggactaaattttcatatatagtaccccctatatgtcagccatcacaattttattggttattgtttaattacatatgtgtttttttgaaggatttaattac |
12216611 |
T |
 |
| Q |
305 |
atatgttagagacatggtttgtttgtaactttt |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12216610 |
atatgttagagacatggtttgtttgtaactttt |
12216578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University