View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20441_low_8 (Length: 261)
Name: NF20441_low_8
Description: NF20441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20441_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 24712443 - 24712245
Alignment:
| Q |
13 |
gcagcacagacatttgcaatgcaacccagtatcagaattaagtaacttagttaagtaattttttatttgaaggaaacttagttaagtaattaaatccggc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24712443 |
gcagcacagacatttgcaatgcaacccagtatcagaattaagtaacttagttaagtaattttttatttgaaggaaacttagttaagtaattaaatccggc |
24712344 |
T |
|
| Q |
113 |
gaaatgttgaatgtagcgaaaattaatttcacgagagcataacgaactatgtggtataacaacttgcctactgttttttctttcacagccgccaaaact |
211 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24712343 |
gaaatgttgaatgtagcaaaaattaatttcacgagagcataacgaactatgtggtataacaacttgcctactgttttttctttcacaaccgccaaaact |
24712245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 155
Target Start/End: Complemental strand, 44667623 - 44667583
Alignment:
| Q |
115 |
aatgttgaatgtagcgaaaattaatttcacgagagcataac |
155 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
44667623 |
aatgttgaatgtagcgaaacttaatttcacaagagcataac |
44667583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University