View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20442_high_10 (Length: 252)

Name: NF20442_high_10
Description: NF20442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20442_high_10
NF20442_high_10
[»] chr2 (1 HSPs)
chr2 (11-196)||(2560333-2560518)
[»] chr8 (1 HSPs)
chr8 (136-195)||(33896840-33896900)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 2560333 - 2560518
Alignment:
11 ttggagttttttcatgcagggttaattgttggttttttctatattacctataaaaaattgagcttttattaccagggtcaatgatagtttatggatgtca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2560333 ttggagttttttcatgcagggttaattgttggttttttctatattacctataaaaaattgagcttttattaccagggtcaatgatagtttatggatgtca 2560432  T
111 cttgaaaatgtacttaagtgtccggtgtttattggtcggagaaattacctactattttttcatggataacctagatgtcaccttaa 196  Q
    |||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||| ||||    
2560433 cttgaaaatgtacttaagtgtccgatgtttattggtcggataaattatctactattttttcatggataatctagatgtcactttaa 2560518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 33896900 - 33896840
Alignment:
136 tgtttattggtcggag-aaattacctactattttttcatggataacctagatgtcacctta 195  Q
    ||||||||||| |||| |||||||| || |||||||||||| || ||||| ||||||||||    
33896900 tgtttattggttggagtaaattacccaccattttttcatgggtaccctagttgtcacctta 33896840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University