View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20442_high_15 (Length: 207)
Name: NF20442_high_15
Description: NF20442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20442_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 77 - 199
Target Start/End: Complemental strand, 32834312 - 32834190
Alignment:
| Q |
77 |
ctgagaagcagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32834312 |
ctgagaagcagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagacttgcctgatgagagaaaccctggaagtcgatgagttctggct |
32834213 |
T |
 |
| Q |
177 |
aaaggagcatccgatttaggatg |
199 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32834212 |
aaaggagcatccgatttaggatg |
32834190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 83 - 199
Target Start/End: Complemental strand, 32840720 - 32840604
Alignment:
| Q |
83 |
agcagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggctaaagga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32840720 |
agcagatggtgctttttcttcttgatcagagttgtctgatgtttcagcagactcgcctgatgagagaaaccctggaagtcgatgagttctggctaaagga |
32840621 |
T |
 |
| Q |
183 |
gcatccgatttaggatg |
199 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
32840620 |
gcatctgatttaggatg |
32840604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 138 - 199
Target Start/End: Original strand, 31682639 - 31682700
Alignment:
| Q |
138 |
cctgatgagagaaaccctggaagtcgatgagttctggctaaaggagcatccgatttaggatg |
199 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
31682639 |
cctgatgagagaaacgatggaagttgatgagttccggctaaaggagcatccgattgaggatg |
31682700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University