View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20442_low_11 (Length: 252)
Name: NF20442_low_11
Description: NF20442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20442_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 11 - 196
Target Start/End: Original strand, 2560333 - 2560518
Alignment:
| Q |
11 |
ttggagttttttcatgcagggttaattgttggttttttctatattacctataaaaaattgagcttttattaccagggtcaatgatagtttatggatgtca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2560333 |
ttggagttttttcatgcagggttaattgttggttttttctatattacctataaaaaattgagcttttattaccagggtcaatgatagtttatggatgtca |
2560432 |
T |
|
| Q |
111 |
cttgaaaatgtacttaagtgtccggtgtttattggtcggagaaattacctactattttttcatggataacctagatgtcaccttaa |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
2560433 |
cttgaaaatgtacttaagtgtccgatgtttattggtcggataaattatctactattttttcatggataatctagatgtcactttaa |
2560518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 33896900 - 33896840
Alignment:
| Q |
136 |
tgtttattggtcggag-aaattacctactattttttcatggataacctagatgtcacctta |
195 |
Q |
| |
|
||||||||||| |||| |||||||| || |||||||||||| || ||||| |||||||||| |
|
|
| T |
33896900 |
tgtttattggttggagtaaattacccaccattttttcatgggtaccctagttgtcacctta |
33896840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University