View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20443_low_8 (Length: 377)

Name: NF20443_low_8
Description: NF20443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20443_low_8
NF20443_low_8
[»] chr2 (2 HSPs)
chr2 (18-122)||(15284646-15284750)
chr2 (112-196)||(15283509-15283593)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 15284750 - 15284646
Alignment:
18 aattggagaattttgagaggagaaaagggaaattgttgaggaaaatcgttaatttggaagaggttgtggatttatctattgagagaaaagggagaagaaa 117  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
15284750 aattggagaattttgagaggggaaaagggaaattgttgaggaaaatcgttaatttagaagaggttgtggatttatctattgagagaaaagggagaagaaa 15284651  T
118 agttg 122  Q
    |||||    
15284650 agttg 15284646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 112 - 196
Target Start/End: Complemental strand, 15283593 - 15283509
Alignment:
112 aagaaaagttggggaggagaatgatagaagggtcataaaaaccattgaaggttatggagaaacacaaaaattggataagtgtgaa 196  Q
    ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15283593 aagaagaggtggggaggagaatgatagaagggtcataaaaaccattgaaggttatggagaaacacaaaaattggataagtgtgaa 15283509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University