View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20443_low_8 (Length: 377)
Name: NF20443_low_8
Description: NF20443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20443_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 18 - 122
Target Start/End: Complemental strand, 15284750 - 15284646
Alignment:
| Q |
18 |
aattggagaattttgagaggagaaaagggaaattgttgaggaaaatcgttaatttggaagaggttgtggatttatctattgagagaaaagggagaagaaa |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15284750 |
aattggagaattttgagaggggaaaagggaaattgttgaggaaaatcgttaatttagaagaggttgtggatttatctattgagagaaaagggagaagaaa |
15284651 |
T |
|
| Q |
118 |
agttg |
122 |
Q |
| |
|
||||| |
|
|
| T |
15284650 |
agttg |
15284646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 112 - 196
Target Start/End: Complemental strand, 15283593 - 15283509
Alignment:
| Q |
112 |
aagaaaagttggggaggagaatgatagaagggtcataaaaaccattgaaggttatggagaaacacaaaaattggataagtgtgaa |
196 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15283593 |
aagaagaggtggggaggagaatgatagaagggtcataaaaaccattgaaggttatggagaaacacaaaaattggataagtgtgaa |
15283509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University