View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20444_low_3 (Length: 360)
Name: NF20444_low_3
Description: NF20444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20444_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 19 - 346
Target Start/End: Complemental strand, 54014002 - 54013680
Alignment:
| Q |
19 |
ggaatacctatctttggggcttcaatgatgggatatggatccggaagtttggtatacggctatgttttgatttttgattttctaagatgcttgggtcatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54014002 |
ggaatacctatctttggggcttcaatgatgggatatggatccggaagtttggtatacggctatgttttgatttttgattttctaagatgcttgggtcatt |
54013903 |
T |
|
| Q |
119 |
gcaacgttgaaataatcccacacaaattgttcaaggcatttccatttcttagatatgtgatatacacaccaacgtaagtttattaaaatttacatttaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54013902 |
gcaacgttgaaataatcccacacaaattgttcaaggcatttccatttcttagatatgtgatacacacaccaacgtaagtttattaaaatttacatttaca |
54013803 |
T |
|
| Q |
219 |
tttgtccaaaatttagattacagttaatgcacccttgaggttgagtaacaaaacaaagtacgaatctctcttacttacactcattacttgttcaattgtc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54013802 |
tttgtccaaaatttagattacagttaatgcacccttgaggttgagtaa-----caaagtacgaatctctcttacttacactcattacttgttcaattgtc |
54013708 |
T |
|
| Q |
319 |
agacacataaaatagccccctcattcat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54013707 |
agacacataaaatagccccctcattcat |
54013680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University