View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20444_low_6 (Length: 234)
Name: NF20444_low_6
Description: NF20444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20444_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 30258001 - 30257796
Alignment:
| Q |
13 |
cagagagcagatgtgaaagattgctgtcaatttgaggtggcccagagttcatgttaggatcctcttgcaaaattttagtaacttgaaaaatggaagtgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30258001 |
cagagagcagatgtgaaagattgctgtcaatttgaggtggcccagagttcatgttaggatcctcttgcaaaattttagtaacttgaaaaatggaagtgta |
30257902 |
T |
 |
| Q |
113 |
aaactttggattaagtttatccggagacttgtaccggtatcgtctatgtggaggagtattgttttcggtccattcaattgtccatccaagataaacaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30257901 |
aaactttggattaagtttatccggagacttgtaccggtatcgtctatgtggaggagtattgttttcggtccattcaattgtccatccaagataaacaaga |
30257802 |
T |
 |
| Q |
213 |
tgtttt |
218 |
Q |
| |
|
|||||| |
|
|
| T |
30257801 |
tgtttt |
30257796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University