View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20444_low_8 (Length: 221)
Name: NF20444_low_8
Description: NF20444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20444_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 209
Target Start/End: Original strand, 50993419 - 50993612
Alignment:
| Q |
16 |
agaagcatggtgtgaaccggacaccgattcagtgtaagaagcgatggggcaatctcaccgcagattataagaagattaaggagtgggagtctcaggtgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50993419 |
agaagcatggtgtgaaccggacaccgattcagtgtaagaagcgatggggcaatctcaccgcagattataagaagattaaggagtgggagtctcaggtgag |
50993518 |
T |
|
| Q |
116 |
tgatgaaactgagtcgttttggttgatgaacgttgagttgaggagagagaggaaattgcctggttgttttgatatagaggtttacaatattctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50993519 |
tgatgaaactgagtcgttttggttgatgaacgttgagttgaggagagagaggaaattgcctggttgttttgatatagaggtttacaatattctt |
50993612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 200
Target Start/End: Complemental strand, 6527056 - 6526880
Alignment:
| Q |
24 |
ggtgtgaaccggacaccgattcagtgtaagaagcgatggggcaatctcaccgcagattataagaagattaaggagtgggagtctcaggtgagtgatgaaa |
123 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||| |||| ||| ||| ||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
6527056 |
ggtgtgaaccggggtccgattcagtgtaggaagcggtggagcaacctcgccggagattataagaagataaaggagtgggagagtcaggtgagagatgaaa |
6526957 |
T |
|
| Q |
124 |
ctgagtcgttttggttgatgaacgttgagttgaggagagagaggaaattgcctggttgttttgatatagaggtttac |
200 |
Q |
| |
|
| ||||||||||||||||||| ||| |||||||||||||||||||||||||| | |||||||| ||||||||| |
|
|
| T |
6526956 |
cggagtcgttttggttgatgaggaatgatttgaggagagagaggaaattgcctgggtattttgataaggaggtttac |
6526880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University