View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20445_low_11 (Length: 265)
Name: NF20445_low_11
Description: NF20445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20445_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 31 - 248
Target Start/End: Original strand, 34326328 - 34326545
Alignment:
| Q |
31 |
acgtgtttttgccgcgatttcgaaaagcttcaaatggtagcttatatgttgacgtaaaaagttacactaatttggttcaacatgatgctttacctaatat |
130 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
34326328 |
acgtgtttttgccgtgatttcaagaagcttcaaatggtagcttctatgttgacgtaaaaagttacagtaatttggttcaacatgatgctttaccaaatat |
34326427 |
T |
|
| Q |
131 |
tatttatgtaatatatgtatcaaatttataattagctgaaattatcaacaacaaatacccacaggaaataaacaagattaatattttgtaatttaattaa |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34326428 |
tatttatgtaatatatgtatcaaatttataattatctgaaattatcaacaacaaatacccacaggaaataaacaagattaatattttgtaatttaattaa |
34326527 |
T |
|
| Q |
231 |
ttatcttaaaatattaag |
248 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
34326528 |
ttatcttaaaatattaag |
34326545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 11679847 - 11679938
Alignment:
| Q |
33 |
gtgtttttgccgcgatttcgaaaagcttcaaatggtagcttatatgttgacgtaaaaagttacactaatttggttcaacatgatgctttacc |
124 |
Q |
| |
|
|||||||||||| ||||| || ||||| ||||||||||||| | |||||||| ||||||| | | |||||||||||| |||||||||||| |
|
|
| T |
11679847 |
gtgtttttgccgtgattttgagaagctccaaatggtagcttctgcgttgacgtgaaaagttttagtgatttggttcaacgtgatgctttacc |
11679938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University