View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20446_high_17 (Length: 268)
Name: NF20446_high_17
Description: NF20446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20446_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 44426345 - 44426102
Alignment:
| Q |
17 |
agttatttcagtttgaatataggaaatcatgtttggatgttgctcatcgctcaatgggttggcaggatcacgacctgattagtggtatttagtatttact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44426345 |
agttatttcagtttgaatataggaaatcatgtttggatgttgctcatcgctcaatgggttggcaggatcacgacctgattagtggtatttagtatttact |
44426246 |
T |
 |
| Q |
117 |
gacatgattcaccatagtttgaactagcttggctttgttattactaggaggatatgcatgaagtgtaacaacgatatccttgatgtcatctaaaattgat |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
44426245 |
gacatgattcaccatagtttgaactggcttggctttgttattactaggaggatatgcatgaagtgtaacaacgatatccttggcgtcacctaaaattgat |
44426146 |
T |
 |
| Q |
217 |
cttgaaagtcagcacacaacgatctttcttaggtttcctatgct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44426145 |
cttgaaagtcagcacacaacgatctttcttaggtttcctatgct |
44426102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University