View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20446_low_16 (Length: 314)
Name: NF20446_low_16
Description: NF20446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20446_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 72 - 295
Target Start/End: Complemental strand, 54880185 - 54879962
Alignment:
| Q |
72 |
ttgcatggcgcaactagtaaattagttttaaactatctcaacaattgatttagattggacgacgacttaggtctataattaattgtgctgcaagaaattt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54880185 |
ttgcatggcgcaactagtaaattagttttaaactatctcaacaattgatttagattggacgacgacttaggtctataattaattgtgctgcaagaaattt |
54880086 |
T |
|
| Q |
172 |
attttcggaggggacatagcatgaggtactcattatatacagaatttaggttgtctagtctagagttaaaatactacacgctccgtgtttannnnnnnga |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54880085 |
attttcggaggggacatagcatgaggtactcattatatacagaatttaggttgtctagtctagagttaaaatactacacgctccgtgtttatttttttga |
54879986 |
T |
|
| Q |
272 |
cagaaacagaactatacatgctgt |
295 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
54879985 |
cagaaacagaactatacatgctgt |
54879962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 54880225 - 54880192
Alignment:
| Q |
19 |
gggagagtctggtttagaattttcaattgcttgc |
52 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
54880225 |
gggagagtctggtttagaatttacaattgcttgc |
54880192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University