View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20446_low_22 (Length: 262)
Name: NF20446_low_22
Description: NF20446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20446_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 237
Target Start/End: Original strand, 12191316 - 12191548
Alignment:
| Q |
5 |
tgccattgatctttctttattgcgggcagagacgccttccaacaacgcatcaatttccacaatgatctcatgttcacagtgccaatattgggnnnnnnnc |
104 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
12191316 |
tgccattgatctttctttatggcgggcagagacgccttccaacaatgcatcaatttccacaatgatctcatgttcaccatgccaatattgggaaaaaaac |
12191415 |
T |
|
| Q |
105 |
tggttcaaaccagtgtattattactacaatggtgttctgcaaccaataactggatcatcaacgaaatattactctagtccaaagattaatatgatgctgc |
204 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12191416 |
tggttcaaaccggtgtattattactacaatggtgttctgcaaccaataactggatcatcaacgaaatattacactagtccaaagattaatatgatgctgc |
12191515 |
T |
|
| Q |
205 |
tgataattcatatgaaatatagttgcttacaat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12191516 |
tgataattcatatgaaatatagttgcttacaat |
12191548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 67
Target Start/End: Original strand, 12185778 - 12185840
Alignment:
| Q |
5 |
tgccattgatctttctttattgcgggcagagacgccttccaacaacgcatcaatttccacaat |
67 |
Q |
| |
|
|||||||||| ||||||||| |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12185778 |
tgccattgatatttctttatggcgggcagcaacaccttccaacaacgcatcaatttccacaat |
12185840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 114 - 166
Target Start/End: Original strand, 12185890 - 12185942
Alignment:
| Q |
114 |
ccagtgtattattactacaatggtgttctgcaaccaataactggatcatcaac |
166 |
Q |
| |
|
||| |||| ||||| |||||||||||| |||||||||||| ||| |||||||| |
|
|
| T |
12185890 |
ccaatgtactattaatacaatggtgttttgcaaccaataattgggtcatcaac |
12185942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University