View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20446_low_36 (Length: 208)

Name: NF20446_low_36
Description: NF20446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20446_low_36
NF20446_low_36
[»] chr4 (1 HSPs)
chr4 (20-192)||(43722383-43722555)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 43722555 - 43722383
Alignment:
20 ggacggatatattggaataattagtttgtgcatttgtggcaatcgaattccaattaacatgacttcaaaccatttagccttgtctttttcaaatattaaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43722555 ggacggatatattggaataattagtttgtgcatttgtggcaatcgaattccaattaacatgacttcaaaccatttagccttgtctttttcaaatattaaa 43722456  T
120 ttcatcaacttagttcatgcatgactcatgagcacgtacaactcagtttgatttgactctgaccccatgcttg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43722455 ttcatcaacttagttcatgcatgactcatgagcacgtacaactcagtttgatttgactctgaccccatgcttg 43722383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University