View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20448_high_10 (Length: 326)
Name: NF20448_high_10
Description: NF20448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20448_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 54736937 - 54737152
Alignment:
| Q |
17 |
aaaattaagcttgaatctgttcctggtgaggatgatggtgctaagtttcggtgtcccgttgcggggcttgagtttaatggaaagtataagtttttcgcgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54736937 |
aaaattaagcttgaatctgttcctggtgaggatgatggtgctaagtttcggtgtcccgttgcggggcttgagtttaatggaaagtataagtttttcgctc |
54737036 |
T |
 |
| Q |
117 |
ttaggaattgtgggcatgttttgagtgctaaggctttgaaagaagttaaatcttcggcgtgtttggtttgtcatgaggaatttggtgagggggataagat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54737037 |
ttaggaattgtgggcatgttttgagtgctaaggctttgaaagaagttaaatcttcggcgtgtttggtttgtcatgaggaatttggtgagggggataagat |
54737136 |
T |
 |
| Q |
217 |
tgtgattaatgggaat |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54737137 |
tgtgattaatgggaat |
54737152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University