View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20448_high_19 (Length: 236)
Name: NF20448_high_19
Description: NF20448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20448_high_19 |
 |  |
|
| [»] scaffold1246 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1246 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold1246
Description:
Target: scaffold1246; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 957 - 753
Alignment:
| Q |
15 |
caaaggcttcaataaggttttcaaaattccttatggtgtgaatttggataagatcaaaggaaattacaatgaagaggaatggattttgaatatttacatg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
957 |
caaaggcttcaataaggttttcaaaattccttatggtgtgaatttggataagatcaaaggaaattacaatgaagaggaatggattttgaatatttacatg |
858 |
T |
 |
| Q |
115 |
ccaaagttggtaaaagggatttttggtcttaaggttgaggaagtcaaggaacaagagaatgataaaagaaaatcagagctagagaaaggtgaaattgatc |
214 |
Q |
| |
|
||||| || |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
857 |
ccaaattttgtaaaagggatttttggtcttaagtttgaggaagtcaaggaacaagagtttgataaaagaatatcagagctagataaatgtgaaattgatc |
758 |
T |
 |
| Q |
215 |
atgtt |
219 |
Q |
| |
|
||||| |
|
|
| T |
757 |
atgtt |
753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University