View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20448_low_21 (Length: 234)
Name: NF20448_low_21
Description: NF20448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20448_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 38581722 - 38581928
Alignment:
| Q |
14 |
gagacattgatttgaacctaaaatcacaacaattgtttttctttgtctttgagaaatatacaccctcttgcaaattacttaactccctccctataaaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581722 |
gagacattgatttgaacctaaaatcacaacaattgtttttctttgtctttgagaaatatacaccctcttgcaaattacttaactccctccctataaaaag |
38581821 |
T |
|
| Q |
114 |
acatcaactagaccatatcttatacaacttcaaaaccatatactaaattcctagagttgagagtaattaaaatatggctgttgtaccaagcaaacgcctt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581822 |
acatcagctagaccatatcttatacaacttcaaaaccatatactaaattcctagagttgagagtgattaaaatatggctgttgtaccaagcaaacgcctt |
38581921 |
T |
|
| Q |
214 |
cttattg |
220 |
Q |
| |
|
||||||| |
|
|
| T |
38581922 |
cttattg |
38581928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University