View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20449_high_2 (Length: 385)
Name: NF20449_high_2
Description: NF20449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20449_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 65 - 381
Target Start/End: Original strand, 9829716 - 9830033
Alignment:
| Q |
65 |
atttttgggatattgagtttgactcctaaaaatagaaagnnnnnnnnn-catgaccacgactttaaaggaaggtagtaaaatagtattccctgttaaaga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9829716 |
atttttgggatattgagtttgactcctaaaaatagaaagaaaaaaaaaacatgaccacgactttaaaggaaggtagtaaaatagtattccctgttaaaga |
9829815 |
T |
 |
| Q |
164 |
gagattgatgagagtcatatagtagttttatcatcatttaggagctagttttaggtcttcctagtaaagtttcagttgttttagtcgagtctttgaaaat |
263 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9829816 |
gagattgatgacagacatatagtagttttatcatcatttaggagctagttttaggtctttctagtaaagtttcagttgttttagtcgagtctttgaaaat |
9829915 |
T |
 |
| Q |
264 |
aaatcaacatggatgcacaaaagagagaaaaatgaagaatgggaccttgaaacatgacaatcactcaaaccaagcaacttcatggtcacattatactttt |
363 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||| || |
|
|
| T |
9829916 |
aaatcaacatggatgcgcaaaagagagaaaaatgaagaatgggaccttgaaacatgacaatcacttaaaccaggcaacttcatggtcgcattatactctt |
9830015 |
T |
 |
| Q |
364 |
tataagaatatcaaagtg |
381 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
9830016 |
tacaagaatatcaaagtg |
9830033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University