View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20450_high_8 (Length: 233)
Name: NF20450_high_8
Description: NF20450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20450_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 9713342 - 9713545
Alignment:
| Q |
14 |
atcaacttcaaacataagttcaagaaaatatatagttgtgacaatttaattcacatgtgtacatnnnnnnnttgacaatgtaaacagtgaacatacttgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
9713342 |
atcaacttcaaacataagttcaagaaaatatatagttgtgacaatttaattcacatgtgtacataaaaaaattgataatgtaaacaatgaacatacttgg |
9713441 |
T |
|
| Q |
114 |
tagaaagagctaatatgttgtgaatattgtcacaggtaaacttggtagcagctgatggtacaccatgatgaaataccaaacgtggatcaacatcactagc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9713442 |
tagaaagagctaatatgttgtgaatattgtcacaggtaaacttggtagcacctgatggcacaccatgatgaaataccaaacgtggatcaacatcactagc |
9713541 |
T |
|
| Q |
214 |
tttt |
217 |
Q |
| |
|
|||| |
|
|
| T |
9713542 |
tttt |
9713545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 210
Target Start/End: Complemental strand, 31105494 - 31105386
Alignment:
| Q |
102 |
gaacatacttggtagaaagagctaatatgttgtgaatattgtcacaggtaaacttggtagcagctgatggtacaccatgatgaaataccaaacgtggatc |
201 |
Q |
| |
|
|||||||||| ||||||||||| | ||| || ||||| |||| ||| |||||||| | || ||||||||| || ||||||||||| | |||||||| |
|
|
| T |
31105494 |
gaacatactttgtagaaagagcaagtatcttctgaatggagtcataggcaaacttggcaccacctgatggtatcccttgatgaaatacaactcgtggatc |
31105395 |
T |
|
| Q |
202 |
aacatcact |
210 |
Q |
| |
|
|||||||| |
|
|
| T |
31105394 |
tacatcact |
31105386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University