View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20450_low_6 (Length: 271)
Name: NF20450_low_6
Description: NF20450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20450_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 14 - 253
Target Start/End: Complemental strand, 1238747 - 1238507
Alignment:
| Q |
14 |
attatactttgtctgaaatttgtatgaagtttagtaaactaaaggtttcttagagaattattactactctaannnnnnnn-ataaaagttgaatgttgga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1238747 |
attatactttgtctgaaatttgtatgaagtttagtaaactaaaggtttcttagagaattattactactctaatttttttttataaaagttgaatgttgga |
1238648 |
T |
 |
| Q |
113 |
agagcccattcaccttttacttggtataaagagaagtgtgaacaaataaaaagaagtttaatcttgtttattttacaaagagacggacattttttatgtc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1238647 |
agagcccattcaccttttacttggtataaagagaagtgtgaacaaataaaaagaagtttaatcttgtttattttacaaagagacggacattttttatgtc |
1238548 |
T |
 |
| Q |
213 |
atacttctttcttgatagatggtcttccttcttaacgaaga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1238547 |
atacttctttcttgatagatggtcttccttcttaacaaaga |
1238507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University