View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20451_low_2 (Length: 435)
Name: NF20451_low_2
Description: NF20451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20451_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 10 - 371
Target Start/End: Original strand, 14002801 - 14003162
Alignment:
| Q |
10 |
agcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataataaaattagagcactttctgaggtgattataaggatgagaatggaagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002801 |
agcagagaaaggagagagatgcaaaagatgcagcatttgttaaagtagataacaaaattagagcactttctgaggtgattataaggatgagaatggaagg |
14002900 |
T |
 |
| Q |
110 |
aggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaagaagtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002901 |
aggaactaaaattgaaatcaaggaggttaacaaagaagcaaataaaaagggttgtgcttttacaccaaattttagacccaaaaaatgtttgaaagaagtt |
14003000 |
T |
 |
| Q |
210 |
aagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtgaaaggatcatatgttagatcaaagcaaaaggataaaataatgatga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003001 |
aagaagattgattgggagaagagtttaagggcaggttcaagccctgttcctgtgaaaggatcatatgttagatcaaagcaaaaggataaaataatgatga |
14003100 |
T |
 |
| Q |
310 |
ggggaaaaaatgcaagtgaggataagaagctacttcaattggtgtggaaggtttaaagctca |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003101 |
ggggaaaaaatgcaagtgaggataagaagctacttcaattggtgtggaaggtttaaagctca |
14003162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University