View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20451_low_4 (Length: 288)
Name: NF20451_low_4
Description: NF20451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20451_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 17 - 277
Target Start/End: Original strand, 15889553 - 15889810
Alignment:
| Q |
17 |
aaaacctacgtgtcaatatgagtgtcgtgtctatatcagtgctttatagattgcaatttggtaaaaccatgaattcttattaaggaacaaaatcactcac |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15889553 |
aaaacctatgtgtcaatatgagtgtcgtgtctatatcagtgct----agattgcaatttggtaaaatcatgaattcttattaaggaacaaaatcactcac |
15889648 |
T |
 |
| Q |
117 |
atttacaattttcttagg-gctaaacagttaaaatgtattatactaaactactagtactaactttcatccaataaaatccaagaattgattaaaatttaa |
215 |
Q |
| |
|
| || ||||| ||||| | || ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
15889649 |
actttcaattctcttaagtgccaaacaattgaaatgtattatactaaactactagtactaactttcatccaataaaatcagaaaattgattaaaatttaa |
15889748 |
T |
 |
| Q |
216 |
caaataatcaatacaagtatattcaaattgatgaaactctagaagaacctggtttgtttctt |
277 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15889749 |
caaataatcaatacaagtatgttcaaattgatgaaactctagaagaacctgctttgtttctt |
15889810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University