View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20453_low_10 (Length: 211)
Name: NF20453_low_10
Description: NF20453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20453_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 204
Target Start/End: Original strand, 31641674 - 31641876
Alignment:
| Q |
2 |
gaggaggagcagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgagg |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31641674 |
gaggaggagaagagaggttggtgtgaaaatttggagattcaggcttgatgttgtggtggagagtattattaaggttgctagggttagggttttgttgagg |
31641773 |
T |
 |
| Q |
102 |
tgggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtgatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31641774 |
tgggtcccaggtgatgtggctttgtgggttttggaaactttgttgttgatttgggaagaggaaaagagattggactaatgggtttgtgtttgtggtggtg |
31641873 |
T |
 |
| Q |
202 |
atg |
204 |
Q |
| |
|
||| |
|
|
| T |
31641874 |
atg |
31641876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University