View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20454_high_5 (Length: 359)
Name: NF20454_high_5
Description: NF20454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20454_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 6 - 330
Target Start/End: Complemental strand, 35410174 - 35409851
Alignment:
| Q |
6 |
gttctttcatttgttctttcactaagtgaagaagataagatctaactatttattctttcnnnnnnnncagaggtttggcggttccagatgccactcagcc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
35410174 |
gttctttcatttgttctttcactaagtgaagaagataagatctaactatttattctttcttttttt-cagaggtttggcggttccagatgccactcggcc |
35410076 |
T |
|
| Q |
106 |
acatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggactagtatagagaagttggtcaggacctatgtgaaccat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410075 |
acatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaagttggtcaggacctatgtgaaccat |
35409976 |
T |
|
| Q |
206 |
tactacaaagatttgaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaaaatgctacct |
305 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409975 |
tactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggcaccctgatcataaaaatgctacct |
35409876 |
T |
|
| Q |
306 |
ggtggcctaaactaaacacccctga |
330 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
35409875 |
ggtggcctaaactaaacacccctga |
35409851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University