View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20455_low_5 (Length: 236)
Name: NF20455_low_5
Description: NF20455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20455_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 44624646 - 44624854
Alignment:
| Q |
12 |
agtagcataggcgccagagagaccggcagcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtg |
111 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44624646 |
agtagcattggcgccagagagaccggcggcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtg |
44624745 |
T |
|
| Q |
112 |
aagtgcttttcagtgtggcgattgagaagactctgtttctcaggttcaaggtttagtctgtgttcgtcgccattaccagccatttgaagtagtgtatgtg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44624746 |
aagtgcttttcagtgtggcgattgagaaggctctgtttctcaggttcaaggtttagtctgtgttcgtcgccattaccagccatttgaagtagtgtatgtg |
44624845 |
T |
|
| Q |
212 |
attactact |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
44624846 |
attactact |
44624854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 21 - 178
Target Start/End: Original strand, 44635904 - 44636061
Alignment:
| Q |
21 |
ggcgccagagagaccggcagcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgtcacggacgatttcacccgcggtgaagtgcttt |
120 |
Q |
| |
|
||||||||||||||||||||| || ||||| || || ||||| || || || | || || |||||||||||||| || ||||| |||||||| |||| |
|
|
| T |
44635904 |
ggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataatgatgtcacggactatgtcaccggcggtgaaatgctcc |
44636003 |
T |
|
| Q |
121 |
tcagtgtggcgattgagaagactctgtttctcaggttcaaggtttagtctgtgttcgt |
178 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44636004 |
tcagtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtgttcgt |
44636061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University