View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_high_24 (Length: 368)
Name: NF20456_high_24
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 50 - 359
Target Start/End: Complemental strand, 52675326 - 52675017
Alignment:
| Q |
50 |
cttttttccttccattctatgcttcgtccccatgcattaacaatattcaagccacaagttcataatatctcttattcaacattttatatttctcaatctt |
149 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52675326 |
cttttttccttccattccatgcttcgtccccatgcattaacaatattcaagccacaagttcataatatctcttattcaacattttatatttctcaatctt |
52675227 |
T |
 |
| Q |
150 |
ttgctgcaacgatgcatgtggaaatcgccaccttctcctccttcctctttacggaaatcaccacaagattccatcccatgtaggtttgacaatctgcttt |
249 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52675226 |
ttgctgcaacgatgcatatggaaatcgccaccttctcctccttcctctttacggaaatcaccacaagattccatcccatgtaggtttgataatctgcttt |
52675127 |
T |
 |
| Q |
250 |
gatttcacttcggtttcgcaactttcatgttgtctaatgcttcgtctaattaaatgttagcacgagcctcttaatgggtgtgtgttttatcttcttttat |
349 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52675126 |
gatttcacttcggtttcgcaacttccatgttgtctaatgcctcgtctaattaaatgttagcacgagcctctcaatgggtgtgtgttttatcttcttttat |
52675027 |
T |
 |
| Q |
350 |
tgatattctt |
359 |
Q |
| |
|
|||| ||||| |
|
|
| T |
52675026 |
tgattttctt |
52675017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University