View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20456_high_30 (Length: 299)

Name: NF20456_high_30
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20456_high_30
NF20456_high_30
[»] chr5 (1 HSPs)
chr5 (244-292)||(41461020-41461068)


Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 41461020 - 41461068
Alignment:
244 ttgtcattagagcacatgttaataaagtagaggtaatgatattcttgga 292  Q
    |||||||||||||||||||||||||||||||||||||||| || |||||    
41461020 ttgtcattagagcacatgttaataaagtagaggtaatgatctttttgga 41461068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University