View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_high_31 (Length: 299)
Name: NF20456_high_31
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 6994481 - 6994226
Alignment:
| Q |
1 |
agtggatactgtcacacctcctcagtgctcatcagatggtgattgattcatcaatcatcaatttatcatgcattaccccccaattatttatctgcagaaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994481 |
agtggatactgtcacacctc---agtgctcatcagatggtgattgattcatcaatcatcaatttatcatgcattaccccccaattatttatctgcagaaa |
6994385 |
T |
 |
| Q |
101 |
gnnnnnnnnnnnt-----------caaatttgaaaagccactctaattccacgaaatttctactggtactacaaatcaatagtttggttttttgcattta |
189 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994384 |
gaagaaaaaaattaaaagaaaaatcaaatttgaaaagccactctaattccacgaaatttctactggtactacaaatcaatagtttggttttttgcattta |
6994285 |
T |
 |
| Q |
190 |
tttcatgtttacaacctttatacataaaaacacaaacaagactcgacttgtttacagtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994284 |
tttcatgtttacaacctttatacataaaaacacaaacaagactcgacttgtttacagtg |
6994226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University