View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_high_47 (Length: 221)
Name: NF20456_high_47
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 58 - 203
Target Start/End: Original strand, 9630477 - 9630622
Alignment:
| Q |
58 |
gattatgtggactatgtcgttgattgttatcggagtgtgtcagaatatgtcatcctataactgaaattttgggtgcaacctttgttatggaaagtcaatt |
157 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9630477 |
gattatgaggaccatgtcattgattgttatcggagtgtgtcagaaggtgtcatcctataactgaaattttgggtgtaacctttgttatggaaagtcaatt |
9630576 |
T |
|
| Q |
158 |
aactccatctaatccagccacaaaatgataatcttaaggtagtact |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9630577 |
aactccatctaatccaaccacaaaatgataatcttaaggtagtact |
9630622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 140 - 201
Target Start/End: Original strand, 9627413 - 9627474
Alignment:
| Q |
140 |
tgttatggaaagtcaattaactccatctaatccagccacaaaatgataatcttaaggtagta |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
9627413 |
tgttatgcgaagtcaattaactccatctaatccagtcacaaaatgataatctttaggtagta |
9627474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 9629860 - 9629893
Alignment:
| Q |
14 |
agatgaattcaaaacaaatggttactctattgct |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9629860 |
agatgaattcaaaacaaatggttactctattgct |
9629893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 201
Target Start/End: Original strand, 9623476 - 9623516
Alignment:
| Q |
161 |
tccatctaatccagccacaaaatgataatcttaaggtagta |
201 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
9623476 |
tccatctaatctagccacaaaatgacaatcttgaggtagta |
9623516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University