View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_low_32 (Length: 299)
Name: NF20456_low_32
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 41461020 - 41461068
Alignment:
| Q |
244 |
ttgtcattagagcacatgttaataaagtagaggtaatgatattcttgga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
41461020 |
ttgtcattagagcacatgttaataaagtagaggtaatgatctttttgga |
41461068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University