View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20456_low_39 (Length: 253)

Name: NF20456_low_39
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20456_low_39
NF20456_low_39
[»] chr7 (2 HSPs)
chr7 (1-119)||(32524489-32524607)
chr7 (1-59)||(45832058-45832116)
[»] chr4 (1 HSPs)
chr4 (1-124)||(43604017-43604139)
[»] chr1 (1 HSPs)
chr1 (133-233)||(39072316-39072416)


Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 32524489 - 32524607
Alignment:
1 atttatccgaaatcacatttatgtgtcttttgaccattttatgacatatctattgatctaaaattgatactttgattatctattttttgcaggtttcaat 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
32524489 atttatccaaaatcacatttatgtgtcttttgaccattttatgacatatctattgatctaaaattgataatttgattatctattttttgcaggtttcaat 32524588  T
101 ggtttttcggtagccaaat 119  Q
    |||||||||||||||||||    
32524589 ggtttttcggtagccaaat 32524607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 45832058 - 45832116
Alignment:
1 atttatccgaaatcacatttatgtgtcttttgaccattttatgacatatctattgatct 59  Q
    |||||| | |||||||| || ||||||||||||| ||| ||||||||||||||||||||    
45832058 atttatgcaaaatcacagttttgtgtcttttgacaattctatgacatatctattgatct 45832116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 43604139 - 43604017
Alignment:
1 atttatccgaaatcacatttatgtgtcttttgaccattttatgacatatctattgatctaaaattgatactttgattatctattttttgcaggtttcaat 100  Q
    |||||| | |||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |    
43604139 atttatgcaaaatcaaatctctgtgtcttttgaccattttatgacatatctattgatctaaaattgatactttgattatctat-ttttgcagatttcagt 43604041  T
101 ggtttttcggtagccaaattcaat 124  Q
    |||||||  |||||||||||||||    
43604040 ggttttttagtagccaaattcaat 43604017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 133 - 233
Target Start/End: Complemental strand, 39072416 - 39072316
Alignment:
133 tgataactttatttgctgatgtgtttgtccaggtcaagttcagtatgtagcataagttattggttgtttgtgcatcattcagaatcaattttctaaggta 232  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||| | ||||||  |||||||||||||||| |||||||||    
39072416 tgataactttagttgctgatgtgtttgtccaggtcaagttcagtatgcagcaaaagttattggctctttgtgtgtcattcagaatcaattatctaaggta 39072317  T
233 c 233  Q
    |    
39072316 c 39072316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University