View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_low_42 (Length: 242)
Name: NF20456_low_42
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 4190334 - 4190559
Alignment:
| Q |
1 |
agttatgtcttttttattttcaaaagtctagttgggaacaaacattaagcataaagaaatagaaaatcatgggttcaaattcacgcaccagaatatcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4190334 |
agttatgtcttttttattttcaagagtctagatgggaacaaacattaagcataaagaaatagaaaatcatgggttcaaattcacgcaccagaatatcaaa |
4190433 |
T |
 |
| Q |
101 |
tgtattatagacttttactatcagagttgtatttaggtcattttattgtgtattgtgtaaaaacgatatcatatcataatagtaannnnnnnnnacagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||| |
|
|
| T |
4190434 |
tgtattatagacttttactatcagagttgtatttaggtcattttattgtgtattgtgtaaaaactatatcatatcataatagtaa-ttttttttactgaa |
4190532 |
T |
 |
| Q |
201 |
gttcatatcatagattcatagtactat |
227 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
4190533 |
gttcatatcatagattcatagcactat |
4190559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University