View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_low_46 (Length: 238)
Name: NF20456_low_46
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 185
Target Start/End: Original strand, 40431496 - 40431669
Alignment:
| Q |
12 |
tattctgcaagagtcctttgatttgaagtttcatatttgcatttttcttttcctcaacagggaacaagcttggctgtccttgttcgataatgtgaagacg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40431496 |
tattctgcaagagtcctttgatttgaagtttcatatttgcatttttcttttcctcaacagggaacaagcttggctgttcttgttcgataatgtgaagacg |
40431595 |
T |
 |
| Q |
112 |
atcgagttcgagatgctttcatcaaacatggaagcacttgtagcttcgaagatgttttgcatttttatgctttc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40431596 |
atcgagttcgagatgctttcatcaaacatggaagcacttgtagcttcgaagatgttttgcatttttatgctttc |
40431669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 40431681 - 40431722
Alignment:
| Q |
179 |
tgctttcatattcatatgcatttgatagtgcttagtactacc |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40431681 |
tgctttcatattcatatgcatttgatagttcttagtactacc |
40431722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 71
Target Start/End: Original strand, 40427732 - 40427768
Alignment:
| Q |
35 |
tgaagtttcatatttgcatttttcttttcctcaacag |
71 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
40427732 |
tgaagtttgatatttgcatttttcttttactcaacag |
40427768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University