View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_low_47 (Length: 237)
Name: NF20456_low_47
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 7948646 - 7948510
Alignment:
| Q |
79 |
tgttatgcccaagattagtttcagaattaatgttgtannnnnnngaagggagaatgaatatggtattaccgtgatgatcttatgactaagtaatggactg |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
7948646 |
tgttatgcccaagattagtttgagaattaatgttgtatttttttgaagggagaatgaatatgatattaccgtgatgatcttatgactaagtaa-----tg |
7948552 |
T |
 |
| Q |
179 |
gttacttgtggacaaagagaagttcatttgtataacaagttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948551 |
gttacttgtggacaaagagaagttcatttgtataacaagttg |
7948510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University