View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20456_low_49 (Length: 230)
Name: NF20456_low_49
Description: NF20456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20456_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 212
Target Start/End: Complemental strand, 34891546 - 34891352
Alignment:
| Q |
16 |
agagaggagtagaaatagtctacaaatataaacaaataatagttaccatccaatttgtgacgctattacgaacttcaaatataaacatatgaaggagata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||| ||||| |
|
|
| T |
34891546 |
agagaggagtagaaatagtctacaaatataaacaaataatagttaccatccaatttgtgacactattacgaacttcaaattt--acatatgaagaagata |
34891449 |
T |
|
| Q |
116 |
aaatccnnnnnnnnnnnnnnnncttgggagtgatatcaaagccatcaagtagtgaaaatgatcaggggagtgttgtcatcatatatgtgactcacac |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34891448 |
aaatccttttttcttttcttttcttgggagtgatatcaaagccatcaagtagtgaaaatgatcaggggagtgttgtcatcatatatgtgactcacac |
34891352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University