View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20457_low_12 (Length: 254)
Name: NF20457_low_12
Description: NF20457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20457_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 37 - 203
Target Start/End: Original strand, 2047465 - 2047630
Alignment:
| Q |
37 |
attgttgtatttttaaagttgaatttaaatctgctttannnnnnngaagaaattgatgatttcatttacatattgtagaaaaatatattagacattggac |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2047465 |
attgttgtatttttaaagttgaatttaaatccactttatttttt-gaagaaattgatgatttcatttacatattgtagaaaaatatattagacattggat |
2047563 |
T |
 |
| Q |
137 |
ccatccatcaatcttattaatgtatcacaatttgtctacttattttttgaattcaaatgatcaactc |
203 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2047564 |
ccatccatcaatctttttaatgtatcacaatttgtctacttattttttgaattcaaatgatcaactc |
2047630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University