View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20457_low_13 (Length: 235)
Name: NF20457_low_13
Description: NF20457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20457_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 2047768 - 2047921
Alignment:
| Q |
1 |
cataaactaccactaacccactattgagtagcgagttactctcttttggtaaatcgtgctttcgtgtagcaatggctcccgatgctgcagccgccgccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2047768 |
cataaactaccactaacccactattgagtagcgagttactctcttttggtaaatcgtgctttcgtgtagcaatggctcccgatgctgcagccgccgccgg |
2047867 |
T |
 |
| Q |
101 |
tggaaagaagagaaaacgctatcttcctcacaacgtatcttctacgtcacttcc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2047868 |
tggaaagaagagaaaacgctatcttcctcacaacgtatcttctacgtcacttcc |
2047921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University