View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20458_high_4 (Length: 237)
Name: NF20458_high_4
Description: NF20458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20458_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 5434191 - 5434056
Alignment:
| Q |
1 |
tttgcttcaaattgaaattaggggacagcaaaatcaaaatcgaggattttactcaactggcttttgtacgattgatacgggatagcaaaattgcaatcga |
100 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434191 |
tttgcttcaaatcgaaa---ggggacagcaaaatcaaaatcgaggattttactcaactggcttttgtacgattgatacgggatagcaaaattgcaatcga |
5434095 |
T |
|
| Q |
101 |
aatcgaaggattttattcaattactttagttagttaatt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434094 |
aatcgaaggattttattcaattactttagttagttaatt |
5434056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University