View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20459_high_3 (Length: 386)
Name: NF20459_high_3
Description: NF20459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20459_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 25172462 - 25172217
Alignment:
| Q |
14 |
atatgctagatttctaactataattcattacattacccttttatttcaaattataattaattgtttgcagattttaggttgagaatgagcacaacaaaac |
113 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
25172462 |
atatgctagatttctaacaataattcattaccttacccttttatttcaaattataattaatagttttcacattttaggttgagaatgagcacaacaaaac |
25172363 |
T |
|
| Q |
114 |
actgacagcatctgttaggaaccggcatcagcaatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgtagtagtattata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25172362 |
actgacagcatctgttaggaaccggcatcagcaatttgaacttgtgttagaaactggctatgatggaaatctaagcgaggtaagttgt---agtattata |
25172266 |
T |
|
| Q |
214 |
catacactatcattgatgtgttttcagttcgctggcataacaatttggc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25172265 |
catacactatcattgatgtgttttcagttcgctggcataaaaatttggc |
25172217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 304 - 369
Target Start/End: Complemental strand, 25172186 - 25172121
Alignment:
| Q |
304 |
gttaactgccgctagttgtaggcagcggaagttaactcacactcagtacctgagttaacttgcgct |
369 |
Q |
| |
|
||||||||||| || ||||||| || ||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
25172186 |
gttaactgccgttaattgtaggtagtagaagttaactcacactcagtacccgagttaacttacgct |
25172121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 306 - 343
Target Start/End: Complemental strand, 32180257 - 32180220
Alignment:
| Q |
306 |
taactgccgctagttgtaggcagcggaagttaactcac |
343 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32180257 |
taactgccgctagttgtaggcagcgcaagttaactcac |
32180220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University