View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_high_13 (Length: 386)
Name: NF2045_high_13
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 17 - 144
Target Start/End: Complemental strand, 16832395 - 16832268
Alignment:
| Q |
17 |
caccttgttccctggtatattttatgttgatattctactttcctatacactaacctgatagagtgatttcttgatattgttaacctttagtttagcactc |
116 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16832395 |
caccttattccctggtacattttgtgttgatattctactttcctataaactaacctgatagagtgatttcttgatattgttaacctttagtttagcactt |
16832296 |
T |
|
| Q |
117 |
gaattttctttattcggaaaaagaaata |
144 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
16832295 |
gaattttctttattcggaaaacgaaata |
16832268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 16978144 - 16978088
Alignment:
| Q |
166 |
ctcacctataaggaaaaagcttttgatcggtttgaaaggttgcgaaacaaaattttg |
222 |
Q |
| |
|
|||||||||||| | ||||||||| ||||||| ||||||||||||| |||| ||||| |
|
|
| T |
16978144 |
ctcacctataagaagaaagcttttcatcggttagaaaggttgcgaatcaaatttttg |
16978088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University