View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_high_28 (Length: 250)
Name: NF2045_high_28
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 41521949 - 41521710
Alignment:
| Q |
1 |
tctgatcggtgattgcatggttataaacagttgcggctgctttagcagcagcaacttggatgtctttaggagaggcactagctgcacgtggcagcacggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41521949 |
tctgatcggtgattgcatggttataaacagttgcggctgctttagcagccgcaacttggatgtctttaggagaggcactagctgcacgtggcagcacggc |
41521850 |
T |
 |
| Q |
101 |
agctaattcgggaaaattgaggtaagccgaagagcctttgatagtaagagcagccacatcatgagctctagcagccatatcaggagttggaaaagttcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41521849 |
agctaattcgggaaaattgaggtaagccgaagagcctttgatagtaagagcagccacatcatgagctctagcagccatatcaggagttggaaaagttccg |
41521750 |
T |
 |
| Q |
201 |
agccaaattctggannnnnnncttggctctctaatctctg |
240 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| |
|
|
| T |
41521749 |
agccaaattcttgatttttttcttggctctctaatctctg |
41521710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 208
Target Start/End: Complemental strand, 3021315 - 3021250
Alignment:
| Q |
143 |
agtaagagcagccacatcatgagctctagcagccatatcaggagttggaaaagttccaagccaaat |
208 |
Q |
| |
|
|||||| ||||| |||||||| || | |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
3021315 |
agtaagtgcagcaacatcatgtgcacgtgcagccatttcaggagttggatatgttccaagccaaat |
3021250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 208
Target Start/End: Complemental strand, 3030529 - 3030464
Alignment:
| Q |
143 |
agtaagagcagccacatcatgagctctagcagccatatcaggagttggaaaagttccaagccaaat |
208 |
Q |
| |
|
|||||| ||||| |||||||| || | |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
3030529 |
agtaagtgcagcaacatcatgtgcacgtgcagccatttcaggagttggatatgttccaagccaaat |
3030464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 143 - 208
Target Start/End: Complemental strand, 3038184 - 3038119
Alignment:
| Q |
143 |
agtaagagcagccacatcatgagctctagcagccatatcaggagttggaaaagttccaagccaaat |
208 |
Q |
| |
|
|||||| ||||| |||||||| || | |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
3038184 |
agtaagtgcagcaacatcatgtgcacgtgcagccatttcaggagttggatatgttccaagccaaat |
3038119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University