View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_low_18 (Length: 337)
Name: NF2045_low_18
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 332
Target Start/End: Complemental strand, 41249310 - 41248999
Alignment:
| Q |
19 |
aattctgtttgtggaaaatgataagctaatttnnnnnnnnnnnnnnnntggtaattattcggtaaaaatgtcatatcttttttgtgcttaggctcgagga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249310 |
aattctgtttgtggaaaatgataagctaatttaaaaagaaaagaaaaatggtaattattcggtaaaaatgtcatatcttttttgtgcttaggctcgagga |
41249211 |
T |
 |
| Q |
119 |
gataaacatataagaagtcgaagaagccaagcaaagatattggaaaccatagctacaattttaggtgctatagtaatattgtttgtcaaaggctcggtta |
218 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249210 |
gataaac--ataagaagtcgaagaagccaagcaaagatattggaaaccatagctacaattttaggtgctatagtaatattgtttgtcaaaggctcggtta |
41249113 |
T |
 |
| Q |
219 |
tttttgggacggttggaggtagccacaacaagcatggtgctgcacatatgatagttggatctatctttataacattataatgttttgtttcagttggact |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249112 |
tttttgggacggttggaggtagccacaacaagcatggtgctgcacatatgatagttggatctatctttataacattataatgttttgtttcagttggact |
41249013 |
T |
 |
| Q |
319 |
tgttctgtgctcct |
332 |
Q |
| |
|
|||| |||| |||| |
|
|
| T |
41249012 |
tgttttgtgatcct |
41248999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University