View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_low_20 (Length: 331)
Name: NF2045_low_20
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 67 - 307
Target Start/End: Complemental strand, 41248558 - 41248318
Alignment:
| Q |
67 |
tataaaatatcattacatatgaaatagttattttattttatttgatcaactagtactaacacagctttgtatctttcttaggctattgcacttgaatctt |
166 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41248558 |
tataaaatattattacatatgaaatagttatttatttttatttgatcaactagtactaacacagctttgtatctttcttaggctattgcacttgaatctt |
41248459 |
T |
|
| Q |
167 |
atcctaaaccactctcactgtcatcatggatatgccaatttgacataattgaaggtgcaacaatggccttgctacagagatggacggaacctcaatttga |
266 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41248458 |
atcctaaaccactctcactctcatcatggatatgccaatttgacataattgaaggtgcaacaatggccttgctacagagatggacgtaacctcaatttga |
41248359 |
T |
|
| Q |
267 |
caccactctccctggtgttctcccacctaatattaattcaa |
307 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41248358 |
caccactctccctagtgttctcccacctaatattaattcaa |
41248318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 41249031 - 41248957
Alignment:
| Q |
1 |
gttttgtttcagttggacttgttttgtgatcctgcatgtgagtttttcaatctcatatttcaataatataaaata |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41249031 |
gttttgtttcagttggacttgttttgtgatcctgcatgtgagtttttcaatctcatatttcaataatataaaata |
41248957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University