View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_low_28 (Length: 252)
Name: NF2045_low_28
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 36 - 236
Target Start/End: Complemental strand, 21526016 - 21525817
Alignment:
| Q |
36 |
gtttttatttaagtaacgtcaaccaaactttaagtgcacctgagtgcacttgctaagaaacctgctcttctctctttgtaccaacccttctccgacatga |
135 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21526016 |
gtttttatttaagtaaagtcaaccaaactttaagtgcacctgagtccacttgctaagaaacctgctcttctctctttgagccaacccttctccgacatga |
21525917 |
T |
 |
| Q |
136 |
attaccttttactatgtatatttgttacaacgtgtactagtgtgttgttgtgaaactcgattttctttctttcaaatcttccttctccgacaagcatttt |
235 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
21525916 |
attaccttttactatgcatatttgttacaacgtgtacttgtgtgttgttgtgaaactcgattttctttctttcaacccttccttctccgac-agcatttt |
21525818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University