View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2045_low_29 (Length: 250)

Name: NF2045_low_29
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2045_low_29
NF2045_low_29
[»] chr4 (1 HSPs)
chr4 (10-250)||(22040786-22041026)


Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 22040786 - 22041026
Alignment:
10 aaaaatatcagatgacacttaaacatgttcatggattatgcacaaagagagccgcaaagatcattaggagaagtaaaaccctaatctttaacgcatctct 109  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22040786 aaaaaaatcagatgacacttaaacatgttcatggattatgcacaaagagagccgcaaagatcattaggagaagtaaaaccctaatctttaacgcatctct 22040885  T
110 tgatggtaatttataaagcagcaatctctacataaagatgagcacttttgatggaaccaaattcttccaaagtttatgactcaccgagattccgccattg 209  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
22040886 tgatggtaatttataaagcagcaatctctacgtaaagatgagcacttttgatggaaccaaattcttccaaagtttacgactcaccgagattccgccattg 22040985  T
210 gcaaaacatataagagatgtcaagaaaagtcgacaacattt 250  Q
    |||||||||||||||||||||||||||||||||||||||||    
22040986 gcaaaacatataagagatgtcaagaaaagtcgacaacattt 22041026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University