View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2045_low_30 (Length: 250)
Name: NF2045_low_30
Description: NF2045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2045_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 41883716 - 41883475
Alignment:
| Q |
1 |
tttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaatggcaacagcaatgggaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883716 |
tttgtgactttaacatgaaggaaaggagccatcaggtttggtaacaacttgaatttcagaaattaagctagaatttcaatggcaacagcaatgggaagtg |
41883617 |
T |
|
| Q |
101 |
acagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaagatgaatgttgtaggtggtacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41883616 |
acagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttattatcacatggacaagatgaatgttgtaggtggtacc |
41883517 |
T |
|
| Q |
201 |
tgcaaaattcactactgccgcaacagtcaagtgcttcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
41883516 |
tgcaaaattcactactgccgcaacagtcaggtgcttcttctc |
41883475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 74 - 166
Target Start/End: Complemental strand, 10267796 - 10267704
Alignment:
| Q |
74 |
tttcaatggcaacagcaatgggaagtgacagatggaaagcccatttggctatggcaatggtgcggttattcaatggtggttaccatgttatta |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
10267796 |
tttcaatggcaacaccaatgggaagtgacacatggaaagcccatttggctatggcaatggtgcagctattcaatggtggttaccacgttatta |
10267704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 10267957 - 10267915
Alignment:
| Q |
1 |
tttgtgactttaacatgaaggaaaggagccatcaggtttggta |
43 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
10267957 |
tttgtgactttaacacgaaggaaaggaaccatcaggtttggta |
10267915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 234
Target Start/End: Original strand, 36372315 - 36372343
Alignment:
| Q |
206 |
aattcactactgccgcaacagtcaagtgc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36372315 |
aattcactactgccgcaacagtcaagtgc |
36372343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University