View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_high_21 (Length: 351)
Name: NF20460_high_21
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 44893158 - 44893486
Alignment:
| Q |
1 |
ggaccactaaggattatgca---tggataatgatatctgtatttttcatttctgaatcgtgttgctggtgctagatagacagcccagaattcaattcaat |
97 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44893158 |
ggaccactaaggattatgcagcatggatgatgatatctgtatttttcttttctgaatcgtgttgctggtgctagatagacagcccagaattca-ttcaat |
44893256 |
T |
 |
| Q |
98 |
tcaattcatgcactgtcggtagtcggtactgctttcttctttctttgtcaccaaccgaatatctccgtgtgcgattgcacaaattaatcttttaagtcaa |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44893257 |
tcaattcatgcactgtcggtagtcgttactgctttcttctttctttgtcaccaaccgaatatctccgtgtgcaattgcacaaattaatcttttaagtcaa |
44893356 |
T |
 |
| Q |
198 |
attaaattgtaataaataacaaaggttttttactattgttgcattttcattattggattcgaacccagactttttagactcgtcaatagagaggatcttc |
297 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44893357 |
attaaattgtaataaataacaaag--tttttactattgttgcattttcattattggattccaacccagactttttagactcgtcaatagagaggatcttc |
44893454 |
T |
 |
| Q |
298 |
gtgttgcaataaacaagatctaatccactcct |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44893455 |
gtgttgcaataaacaagatctaatccactcct |
44893486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University