View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20460_high_29 (Length: 268)

Name: NF20460_high_29
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20460_high_29
NF20460_high_29
[»] chr2 (1 HSPs)
chr2 (13-248)||(6292661-6292888)


Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 6292888 - 6292661
Alignment:
13 gatgaatgtaatacttaaccaactatttatagtggacaatattagttagttaataacttgttaaactttatgattcataatttaaataaatcnnnnnnnt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||       |    
6292888 gatgaatgtaatacttaaccaactatttatagtggacaatattagttagttaataactagttaaactttatgattcataatttaaataaatcaaaaaaat 6292789  T
113 tataacttttagttcataactcttcatacaaattgtttaaaaattcttatgccaatggtggtgatgcatatgatttaccttaatcttagtagaagaggag 212  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||   ||||||||||     ||||||||||||||||||||||||||||    
6292788 tataacttatagttcataactcttcatacaaattgtttaaaaattcttatgcca---gtggtgatgc-----atttaccttaatcttagtagaagaggag 6292697  T
213 gcaatagaaaatgaaccggaagcagatggtgacgac 248  Q
    ||||||||||||||||||||||||||||||||||||    
6292696 gcaatagaaaatgaaccggaagcagatggtgacgac 6292661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University