View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_high_29 (Length: 268)
Name: NF20460_high_29
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 13 - 248
Target Start/End: Complemental strand, 6292888 - 6292661
Alignment:
| Q |
13 |
gatgaatgtaatacttaaccaactatttatagtggacaatattagttagttaataacttgttaaactttatgattcataatttaaataaatcnnnnnnnt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
6292888 |
gatgaatgtaatacttaaccaactatttatagtggacaatattagttagttaataactagttaaactttatgattcataatttaaataaatcaaaaaaat |
6292789 |
T |
 |
| Q |
113 |
tataacttttagttcataactcttcatacaaattgtttaaaaattcttatgccaatggtggtgatgcatatgatttaccttaatcttagtagaagaggag |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6292788 |
tataacttatagttcataactcttcatacaaattgtttaaaaattcttatgcca---gtggtgatgc-----atttaccttaatcttagtagaagaggag |
6292697 |
T |
 |
| Q |
213 |
gcaatagaaaatgaaccggaagcagatggtgacgac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6292696 |
gcaatagaaaatgaaccggaagcagatggtgacgac |
6292661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University