View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20460_high_34 (Length: 225)
Name: NF20460_high_34
Description: NF20460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20460_high_34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 225
Target Start/End: Original strand, 23908226 - 23908441
Alignment:
| Q |
10 |
attatactgctgaggctaaataacgagaaacaactttggctagtagggggatcataaaggtctgtggtaaagagcggcggtacttagtttggtggaaaat |
109 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23908226 |
attatattgttgaggctaaataacgagaaacaactttggctagtagggggatcataaaggtctgtggtaaagagcggcggtacttagtttggtggaaaat |
23908325 |
T |
 |
| Q |
110 |
cttggttgttgaggtttctacttggaattttgccacaatctatgttacgatcacacaatttacgattctaactttctctcccatgtccaaaaaatatctt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23908326 |
cttggttgttgaggtttctacttggaattttgccacaatctatgttacgatcacacaatttacaattctaactttctctcccatgtccaaaaaatatctt |
23908425 |
T |
 |
| Q |
210 |
gattttgacacaaatt |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23908426 |
gattttgacacaaatt |
23908441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University